알림
뒤로

VectorOmicron Spike Pseudotyping Vector

InvivoGen
조회수 4919

Omicron Variant (B.1.1.529/BA.1) Spike Pseudotyping Vector (#plv-spike-v11)

SARS-CoV-2 Spike (B.1.1.529/BA.1 - South Africa, Nov. 2021)을 이용한 Lentiviral particle pseudotyping
#plv-spike-v11는 reporter & accessory protein을 encoding 하는 plasmid와 co-transfection 시 SARS-CoV-2 Spike (S) protein을 이용한 lentiviral particle pseudotyping을 위하여 설계되었습니다. 
#pLV-SpikeV11는 Omicron variant (B1.1.529/BA.1)의 full-length Spike sequence를 encoding 하며, 최적의 발현을 위하여 codon-optimized 및 C‑terminal ER-retention signal이 제거되었습니다. 

Gene Description 
#plv-spike-v11은 2021년 남아프리카공화국에서 처음 보고된 SARS-CoV-2 Omicron variant의 Spike protein을 encoding 합니다. Omicron Variant (B.1.1.529/BA.1)는 Clade 21K/ B.1.1.529(BA.1) 계통 (Nextstrain/Pango lineage classification) 으로 분류되며, Spike coding region에 여러 돌연변이가 존재하는 것을 특징으로 합니다. 그 중 아래와 같은 돌연변이가 주목됩니다.

  • S1 domain: A67V, deletion (Δ)H69-V70, T95I, G142D, ΔV143-Y145, ΔN211, L212I, ins214EPE, T547K, D614G, H655Y, N679K, P681H
  • RBD: G339D, S371L, S373P, S375F, K417N, N440K, G446S, S477N, T478K, E484A, Q493R, Q498R, N501Y, Y505H
  • S2 domain: N764K, D796Y, N856K, Q954H, N969K, L981F
fe64863c8fc84.png

Applications

  • Reporter & accessory protein plasmid (별도 구매)와 co-transfection 시 Spike pseudotyped lentiviral particle 생성
  • Small molecules, monoclonal antibody 및 convalescent plasma를 비롯한 SARS-CoV-2 inhibitor 스크리닝


Specifications

  • Origin: Omicron variant (B.1.1.529/BA.1 lineage)
  • Sequence Reference: EPI_ISL_6841980
  • Codon Optimized
  • ORF size: 3756 bp
  • Sequencing primers:
    - Forward rbt β-globin intron: TGGTTACAATGATATACACTG
    - Reverse rbt β-globin pAn: CTCAAGGGGCTTCATGATGTC
  • Quality Control:
    - Plasmid construct is confirmed by restriction analysis and full‑length open reading frame (ORF) sequencing.
    - After purification by ion-exchange chromatography, predominant supercoiled conformation is verified by electrophoresis.

Omicron Variant (BA.2) Spike Pseudotyping Vector (#plv-spike-v12)

SARS-CoV-2 Spike (BA.2 - South Africa, Nov. 2021)을 이용한 Lentiviral particle pseudotyping
#plv-spike-v12는 reporter & accessory protein을 encoding 하는 plasmid와 co-transfection 시 SARS-CoV-2 Spike (S) protein을 이용한 lentiviral particle pseudotyping을 위하여 설계되었습니다. 
#pLV-Spike-v12는 Omicron variant (BA.2 lineage)의 full-length Spike sequence를 encoding 하며, 최적의 발현을 위하여 codon-optimized 및 C‑terminal ER-retention signal이 제거되었습니다.

Gene Description

#plv-spike-v12는 2021년 남아프리카공화국에서 처음 보고된 SARS-CoV-2 Omicron BA.2 variant의 Spike protein을 encoding 합니다. Omicron BA.2는 Clade 21L/BA.2 계통 (Nextstrain/Pango lineage classification) 으로 분류되며, Spike coding region에 여러 돌연변이가 존재하는 것을 특징으로 합니다. 그 중 아래와 같은 돌연변이가 주목됩니다.

  • S1 domain: T19I, deletion (Δ)L24-P26, A27S, G142D, V213G, D614G, H655Y, N679K, P681H
  • RBD: G339D, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, S477N, T478K, E484A, Q493R, Q498R, N501Y, Y505H
  • S2 domain: N764K, D796Y, Q954H, N969K
bbaa45de1f3f0.png

Applications

  • Reporter & accessory protein plasmid (별도 구매)와 co-transfection 시 Spike pseudotyped lentiviral particle 생성
  • Small molecules, monoclonal antibody 및 convalescent plasma를 비롯한 SARS-CoV-2 inhibitor 스크리닝


Specifications

  • Origin: Omicron variant (BA.2 lineage)
  • Sequence Reference: EPI_ISL_6795834.2
  • Codon Optimized
  • ORF size: 3756 bp
  • Sequencing primers:
    - Forward rbt β-globin intron: TGGTTACAATGATATACACTG
    - Reverse rbt β-globin pAn: CTCAAGGGGCTTCATGATGTC
  • Quality Control:
    - Plasmid construct is confirmed by restriction analysis and full‑length open reading frame (ORF) sequencing.
    - After purification by ion-exchange chromatography, predominant supercoiled conformation is verified by electrophoresis.

Ordering information

ProductDescriptionCat no.Size
pLV-SpikeV11Spike pseudotyping plasmid - Omicron Variant (B.1.1.529/BA.1)plv-spike-v1120 µg
pLV-SpikeV12Spike pseudotyping plasmid - Omicron Variant (BA.2)plv-spike-v1220 µg


#invivogen #다윈바이오 #Plasmid #Vector #COVID 

[학술문의] T. 031-728-3236 E. technical@dawinbio.com

Reporter cell lines_ver.2 Anti-PD-1/PD-L1 Cell-based Assay
목록
TOP